Skip to main content
Addgene

U6>Control(F+E)
(Plasmid #60006)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60006 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCESAx
  • Modifications to backbone
    Mutated BsaI sites in backbone
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Control (F+E) sgRNA
  • Promoter Ciinte.U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer cccaagcgagtgtttgttac
  • 3′ sequencing primer GGATTTCCTTACGCGAAATACG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

U6 promoter based on Nishiyama, A. and Fujiwara, S. (2008). RNA interference by expressing short hairpin RNA in the Ciona intestinalis embryo. Dev. growth … 521–529.

sgRNA F+E scaffold based on Chen, B., Gilbert, L. a, Cimini, B. a, Schnitzbauer, J., Zhang, W., Li, G.-W., Park, J., Blackburn, E. H., Weissman, J. S., Qi, L. S., et al. (2013). Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479–91.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6>Control(F+E) was a gift from Lionel Christiaen (Addgene plasmid # 60006 ; http://n2t.net/addgene:60006 ; RRID:Addgene_60006)

  • For your References section:

    Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Stolfi A, Gandhi S, Salek F, Christiaen L. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. 10.1242/dev.114488 PubMed 25336740
Related items:
Commonly requested with: