U6>sgRNA(F+E)
(Plasmid #59986)

• Purpose: (Empty Backbone) Empty vector for sgRNA cloning (F+E modified backbone)
• Depositing Lab: Lionel Christiaen
• Publication: Stolfi et al Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488.

Backbone

• Vector backbone: pCESAx
• Modifications to backbone: Mutated BsaI sites in backbone
• Vector type: CRISPR
• Promoter: Ciinte.U6

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Cloning Information

• 5′ sequencing primer: cccaagcgagtgtttgttac
• 3′ sequencing primer: GGATTTCCTTACGCGAAATACG

Resource Information

• Supplemental Documents:
  • U6>sgRNA(F+E)
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

U6 promoter based on Nishiyama, A. and Fujiwara, S. (2008). RNA interference by expressing short hairpin RNA in the Ciona intestinalis embryo. Dev. growth … 521–529.

sgRNA F+E scaffold based on Chen, B., Gilbert, L. a, Cimini, B. a, Schnitzbauer, J., Zhang, W., Li, G.-W., Park, J., Blackburn, E. H., Weissman, J. S., Qi, L. S., et al. (2013). Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479–91.