pDCC6
(Plasmid #59985)

• Purpose: Bi-cistronic Drosophila CRISPR/Cas9 vector, contains hsp70>Cas9 and U6>sgRNA cassette
• Depositing Lab: Peter Duchek
• Publication: Gokcezade et al G3 (Bethesda). 2014 Sep 17. pii: g3.114.014126. doi: 10.1534/g3.114.014126.

Backbone

• Vector backbone: pHW
• Total vector size (bp): 8122
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Alt name: 3xFLAG-hSpCas9
• Species: Synthetic; S. pyogenes
• Insert Size (bp): 4266
• Promoter: hsp70Bb
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GCGCTTCCGGAGGTATACACC

Gene/Insert 2

• Gene/Insert name: U6-2>sgRNA
• Species: Synthetic
• Insert Size (bp): 501
• Promoter: U6-96Ab

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CGAACTGTGTTTTCAACAAACG

Resource Information

• Supplemental Documents:
  • GenBank pDCC6
• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry