-
PurposeBi-cistronic Drosophila CRISPR/Cas9 vector, contains hsp70>Cas9-D10A nickase and U6>sgRNA cassette
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59984 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepHW
- Total vector size (bp) 8088
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9-D10A
-
Alt nameHA-hSpCas9-D10A
-
SpeciesSynthetic
-
Insert Size (bp)4209
-
MutationD10A
- Promoter hsp70Bb
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GCGCTTCCGGAGGTATACACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDCC5 was a gift from Peter Duchek (Addgene plasmid # 59984 ; http://n2t.net/addgene:59984 ; RRID:Addgene_59984) -
For your References section:
Efficient CRISPR/Cas9 Plasmids for Rapid and Versatile Genome Editing in Drosophila. Gokcezade J, Sienski G, Duchek P. G3 (Bethesda). 2014 Sep 17. pii: g3.114.014126. doi: 10.1534/g3.114.014126. 10.1534/g3.114.014126 PubMed 25236734
Map uploaded by the depositor.
