pBbE1k-2
(Plasmid #59945)

• Purpose: dihydropterine reductase from human, pterin-4a-carbinolamine dehydratase from human
• Depositing Lab: Taek Soon Lee
• Publication: Satoh et al Metab Eng. 2012 Nov;14(6):603-10. doi: 10.1016/j.ymben.2012.08.002. Epub 2012 Aug 29.

Backbone

• Vector backbone: pBbE1k
• Backbone size w/o insert (bp): 3550
• Total vector size (bp): 4598

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: dihydropterine reductase
• Alt name: DHPR
• Insert Size (bp): 734
• Promoter: pTrc

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: AACTATCCGCTGGATGACCA
• 3′ sequencing primer: CGTTCTTTCGGTAGGTCAAA

Gene/Insert 2

• Gene/Insert name: pterin-4a-carbinolamine dehydratase
• Alt name: PCD
• Insert Size (bp): 314
• Promoter: pTrc

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: AACTATCCGCTGGATGACCA
• 3′ sequencing primer: CGTTCTTTCGGTAGGTCAAA

Resource Information

• Supplemental Documents:
  • pBbE1k-2

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry