-
PurposeExpresses mouse interleukin-2 receptor alpha chain
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepScalps
- Backbone size w/o insert (bp) 7740
- Total vector size (bp) 8547
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameinterleukin 2 receptor alpha
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)807
-
Entrez GeneIl2ra (a.k.a. CD25, Il2r, Ly-43)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BAMHI (not destroyed)
- 3′ cloning site XHOI (not destroyed)
- 5′ sequencing primer GCTTCTCGCTTCTGTTCG
- 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pScalps_puro_mIL-2Rα was a gift from Silvia Monticelli (Addgene plasmid # 59917 ; http://n2t.net/addgene:59917 ; RRID:Addgene_59917) -
For your References section:
Two Functionally Distinct Subsets of Mast Cells Discriminated By IL-2-Independent CD25 Activities. Deho' L, Leoni C, Brodie TM, Montagner S, De Simone M, Polletti S, Barozzi I, Natoli G, Monticelli S. J Immunol. 2014 Sep 1;193(5):2196-206. doi: 10.4049/jimmunol.1400516. Epub 2014 Jul 25. 10.4049/jimmunol.1400516 PubMed 25063866