TRMPVneo.Yap.3093
(Plasmid
#59915)
-
PurposeTet on shRNA for conditional Yap1 knockdown
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTRMPVneo
-
Backbone manufacturerScott Lowe
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYap1
-
gRNA/shRNA sequenceYap1
-
SpeciesM. musculus (mouse)
-
Entrez GeneYap1 (a.k.a. Yap, Yap65, Yki, Yorkie)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer miR30seq tgtttgaatgaggcttcagtac
- 3′ sequencing primer PGKR (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRMPVneo.Yap.3093 was a gift from Tyler Jacks (Addgene plasmid # 59915 ; http://n2t.net/addgene:59915 ; RRID:Addgene_59915) -
For your References section:
KRAS and YAP1 Converge to Regulate EMT and Tumor Survival. Shao DD, Xue W, Krall EB, Bhutkar A, Piccioni F, Wang X, Schinzel AC, Sood S, Rosenbluh J, Kim JW, Zwang Y, Roberts TM, Root DE, Jacks T, Hahn WC. Cell. 2014 Jul 3;158(1):171-84. doi: 10.1016/j.cell.2014.06.004. Epub 2014 Jun 19. 10.1016/j.cell.2014.06.004 PubMed 24954536