pQL269
(Plasmid #59802)

• Purpose: (Empty Backbone) The univector plasmid-fusion system (UPS) uses Cre– lox site-specific recombination to fuse a plasmid containing the gene of interest and host vectors containing regulatory information.
• Depositing Lab: Stephen Elledge
• Publication: Liu et al Curr Biol. 1998 Dec 3;8(24):1300-9.

Backbone

• Vector backbone: pINTts
• Backbone manufacturer: Haldimann,A. and Wanner,B.L.
• Backbone size (bp): 2000
• Modifications to backbone: The pQL269 plasmid (lac–cre,SpR, and ori Ts) was constructed by ligating the EcoRI–PvuII fragment from pQL114, containing aadA (conferring spectinomycin resistance) and the lac–cre chimeric gene, to a BglI(blunt)– EcoRI fragment containing the temperature-senstive replication origin from pINT-ts.
• Vector type: Bacterial Expression, Cre/Lox
• Promoter: lambdaPR

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): BUN14
• Growth instructions: Temperature sensitivity strain; grow at 42
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: GCAAACGGACAGAAGCATTT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry