pCAG-Chimeric_Butterfly_YR_1.0
(Plasmid #59801)

• Purpose: Genetically encoded fluorescent voltage indicator
• Depositing Lab: Thomas Knopfel
• Publication: Mishina et al Front Mol Neurosci. 2014 Sep 29;7:78. doi: 10.3389/fnmol.2014.00078. eCollection 2014.

Backbone

• Vector backbone: pCAG
• Backbone manufacturer: Custom
• Backbone size w/o insert (bp): 4796
• Total vector size (bp): 6863
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Yellow-Red Chimeric Butterfly Voltage Sensitive Fluorescent Protein
• Alt name: VSFP
• Species: Synthetic
• Insert Size (bp): 2034
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: AflII (unknown if destroyed)
• 5′ sequencing primer: ttcggcttctggcgtgtgacc
• 3′ sequencing primer: tagccagaagtcagatgctcaagG

Resource Information

• Supplemental Documents:
  • Genbank file
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry