GFP-APPL1-ΔPTB
(Plasmid
#59768)
-
PurposeExpresses APPL1 with PTB domain deleted
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59768 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepIRES2
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAPPL1
-
SpeciesH. sapiens (human)
-
Mutationdeleted amino acids 467-709
-
GenBank IDNM_012096.2
-
Entrez GeneAPPL1 (a.k.a. APPL, DIP13alpha, MODY14)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tcgaattcggcttatgccgg
- 3′ sequencing primer taggtacccaggctgatcttcacacac (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-APPL1-ΔPTB was a gift from Donna Webb (Addgene plasmid # 59768 ; http://n2t.net/addgene:59768 ; RRID:Addgene_59768) -
For your References section:
The endosomal adaptor protein APPL1 impairs the turnover of leading edge adhesions to regulate cell migration. Broussard JA, Lin WH, Majumdar D, Anderson B, Eason B, Brown CM, Webb DJ. Mol Biol Cell. 2012 Apr;23(8):1486-99. doi: 10.1091/mbc.E11-02-0124. Epub 2012 Feb 29. 10.1091/mbc.E11-02-0124 PubMed 22379109