pCAG-T3-hCASeGFP-pA
(Plasmid #59766)

• Purpose: Expresses CAS9-eGFP fusion protein in mammalian cells.
• Depositing Lab: Wataru Fujii
• Publication: Fujii et al Nucleic Acids Res. 2013 Aug 30.

Backbone

• Vector backbone: pCAGGS
• Total vector size (bp): 10017
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CAS9
• Species: Synthetic
• Insert Size (bp): 4188
• Promoter: CAG
• Tags / Fusion Proteins:
  • eGFP (C terminal on insert)
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGTCCCCTTCTCCCTCTC
• 3′ sequencing primer: ATTTTTGGCAGAGGGAAAAAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The human codon-optimized hCas9 insert in this vector was amplified from plasmid hCas9 (George Church; Addgene #41815).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The eGFP ORF was inserted into C-terminal of CAS9 ORF of
pCAG-T3-hCAS-pA (Addgene Plasmid #48625).

For the in vitro synthesis of CAS9 mRNAs, the vector was linearized by SphI and in-vitro transcribed using T3-RNA-polymerase (Promega) in the presence of m7G(5′)ppp(5′)G to synthesize capped RNA.

The Tbpl1 3′UTR 95 nucleotide polyA tail at the 3' end of the insert allows in vitro transcribed mRNA from this plasmid to be used directly for microinjection into animal embryos or oocytes without additional polyadenylation treatment.

The CAG promoter in this plasmid also allows it to be used as a CAS9eGFP-expression vector.