pBSWt1-Dest
(Plasmid
#59764)
-
PurposePCR template for amplifying the attL1-em7-kanr-attL2-pA cassette
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript SKII-
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameattL1-em7-kanR-attL2-pA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTGCGTCCAGCAGCCGGAGCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBSWt1-Dest was a gift from Peter Koopman (Addgene plasmid # 59764 ; http://n2t.net/addgene:59764 ; RRID:Addgene_59764) -
For your References section:
A piggyBac transposon- and gateway-enhanced system for efficient BAC transgenesis. Zhao L, Ng ET, Koopman P. Dev Dyn. 2014 Jun 12. doi: 10.1002/dvdy.24153. 10.1002/dvdy.24153 PubMed 24924516