-
PurposeExpress wild-type form of Ran-mRFP1 in mammalian cells (CMV promoter). Also suitable for in vitro transcription (T7 promoter) for injecting mRNA into oocytes.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59750 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1-polyA
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRan-mRFP1
-
SpeciesM. musculus (mouse)
- Promoter CMV and T7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CACTGCTTACTGGCTTATCG
- 3′ sequencing primer CCAAACTTTTATTTGTGCACAT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-RanWT-mRFP1-polyA was a gift from Yi Zhang (Addgene plasmid # 59750 ; http://n2t.net/addgene:59750 ; RRID:Addgene_59750) -
For your References section:
Nucleosome assembly is required for nuclear pore complex assembly in mouse zygotes. Inoue A, Zhang Y. Nat Struct Mol Biol. 2014 Jul;21(7):609-16. doi: 10.1038/nsmb.2839. Epub 2014 Jun 8. 10.1038/nsmb.2839 PubMed 24908396