Flag-PML IV/pRK5
(Plasmid #59742)

• Purpose: Expresses the isoform IV of Promyelocytic Leukemia Protein (PML) in mammalian cells
• Depositing Lab: Xiaolu Yang
• Publication: Guo et al Mol Cell. 2014 Jul 3;55(1):15-30. doi: 10.1016/j.molcel.2014.04.030. Epub 2014 May 29.

Backbone

• Vector backbone: pRK5
• Backbone size w/o insert (bp): 4713
• Total vector size (bp): 6700
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PML isoform IV
• Species: H. sapiens (human)
• Insert Size (bp): 1938
• GenBank ID: NM_002675.3
• Entrez Gene: PML (a.k.a. MYL, PP8675, RNF71, TRIM19)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: TTGCCTTTCTCTCCACAGGTGT
• 3′ sequencing primer: GGACAAACCACACTAGAATGCAGT

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry