pBSVSG221KOblast
(Plasmid
#59733)
-
PurposeFor replacement of VSG221 with a blasticidin resistence gene in the VSG221 expression site in T.brucei.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59733 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescriptII
- Backbone size w/o insert (bp) 2901
- Total vector size (bp) 4654
-
Vector typeFor homologous recombination into VSG221 expression site in T. brucei
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsBL21(DE3) is recommended by the depositing lab
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVSG221 knockout construct
-
SpeciesTrypanosoma brucei Lister 427
-
Insert Size (bp)1753
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer gctccaccgcggtggcggcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBSVSG221KOblast was a gift from Gloria Rudenko (Addgene plasmid # 59733 ; http://n2t.net/addgene:59733 ; RRID:Addgene_59733)