Skip to main content
Addgene

pET14b_tev_PSG
(Plasmid #59731)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59731 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET14b_TEV
  • Backbone manufacturer
    EMD Millipore
  • Backbone size w/o insert (bp) 4670
  • Total vector size (bp) 5905
  • Modifications to backbone
    Thrombin cleavage site of pET14b replaced by TEV protease cleavage site.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    See primary reference
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TJP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1235
  • Entrez Gene
    TJP1 (a.k.a. ZO-1)
  • Tags / Fusion Proteins
    • HIS (N terminal on insert)
    • TEV (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nde I (not destroyed)
  • 3′ cloning site Bam HI (not destroyed)
  • 5′ sequencing primer T7 fwd
  • 3′ sequencing primer CACCCGTCCTGTGGATATCCG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET14b_tev_PSG was a gift from Alan Fanning (Addgene plasmid # 59731 ; http://n2t.net/addgene:59731 ; RRID:Addgene_59731)

  • For your References section:

    The Src homology 3 domain is required for junctional adhesion molecule binding to the third PDZ domain of the scaffolding protein ZO-1. Nomme J, Fanning AS, Caffrey M, Lye MF, Anderson JM, Lavie A. J Biol Chem. 2011 Dec 16;286(50):43352-60. doi: 10.1074/jbc.M111.304089. Epub 2011 Oct 26. 10.1074/jbc.M111.304089 PubMed 22030391
Related items:
Commonly requested with: