Skip to main content
Addgene

pGEX-GP-2-CBX7 Chromo
(Plasmid #59695)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59695 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-6p-2
  • Total vector size (bp) 5131
  • Vector type
    Bacterial Expression
  • Selectable markers
    Ampicilin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CBX7 Chromo
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    194
  • Entrez Gene
    CBX7
  • Promoter tac promoter
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-GP-2-CBX7 Chromo was a gift from Albert Jeltsch (Addgene plasmid # 59695 ; http://n2t.net/addgene:59695 ; RRID:Addgene_59695)
  • For your References section:

    Application of histone modification-specific interaction domains as an alternative to antibodies. Kungulovski G, Kycia I, Tamas R, Jurkowska RZ, Kudithipudi S, Henry C, Reinhardt R, Labhart P, Jeltsch A. Genome Res. 2014 Nov;24(11):1842-53. doi: 10.1101/gr.170985.113. Epub 2014 Oct 9. 10.1101/gr.170985.113 PubMed 25301795