pGEX-GP-2-MPHOSPH8 Chromo
(Plasmid #59694)

• Purpose: Contains histone modification interacting domain (MPHOSPH8 Chromo)
• Depositing Lab: Albert Jeltsch
• Publication: Kungulovski et al Genome Res. 2014 Nov;24(11):1842-53. doi: 10.1101/gr.170985.113. Epub 2014 Oct 9.

Backbone

• Vector backbone: pGEX-6p-2
• Total vector size (bp): 5131
• Vector type: Bacterial Expression
• Selectable markers: Ampicilin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MPHOSPH8 Chromo
• Alt name: MPP8 Chromo
• Species: H. sapiens (human)
• Insert Size (bp): 194
• Entrez Gene: MPHOSPH8 (a.k.a. HSMPP8, TWA3, mpp8)
• Promoter: tac promoter
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: CCGGGAGCTGCATGTGTCAGAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry