pLNCX2-CFP-VGPDFGR-YFP
(Plasmid #59587)

• Purpose: Encodes a granzyme B FRET reporter
• Depositing Lab: Tim Mitchison
• Publication: Choi et al Proc Natl Acad Sci U S A. 2013 Apr 16;110(16):6488-93. doi: 10.1073/pnas.1221312110. Epub 2013 Apr 1.

Backbone

• Vector backbone: pLNCX2
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6097
• Total vector size (bp): 7634
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ECFP-VGPDFGR-Venus
• Alt name: GZMB FRET reporter
• Alt name: granzyme B FRET reporter
• Species: Synthetic
• Insert Size (bp): 1537
• Promoter: CMV
• Tags / Fusion Proteins:
  • ECFP
  • Venus

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl2 (destroyed during cloning)
• 3′ cloning site: SalI (destroyed during cloning)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ECFP and Venus genes were cloned from Addgene 24537.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry