Dead Streptavidin-SpyTag
(Plasmid #59548)

• Purpose: pET21-DTag encodes Dead streptavidin (negligible biotin binding) bearing a C-terminal SpyTag, for generation of chimeric SpyAvidin tetramers
• Depositing Lab: Mark Howarth
• Publication: Fairhead et al J Am Chem Soc. 2014 Sep 3;136(35):12355-63. doi: 10.1021/ja505584f. Epub 2014 Aug 21.

Backbone

• Vector backbone: pET21a
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 5844
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5alpha for propagation of the plasmid. Bl21[DE3] or similar required for protein expression.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Dead Streptavidin-SpyTag
• Alt name: DTag
• Species: E.Coli
• Insert Size (bp): 444
• Mutation: The construct lacks final K of SpyTag
• Promoter: T7
• Tag / Fusion Protein:
  • SpyTag (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CTAGTTATTGCTCAGCGGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry