Tol2-elavl3-GCaMP6s
(Plasmid #59531)

• Purpose: Expressed GCaMP6-slow, a calcium indicator, in neurons in zebrafish larva. The plasmid is in Tol2 transposon backbone
• Depositing Lab: Misha Ahrens
• Publication: Vladimirov et al Nat Methods. 2014 Jul 27. doi: 10.1038/nmeth.3040.

Backbone

• Vector backbone: MiniTol2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: elavl3 promoter
• Alt name: HuC
• Species: D. rerio (zebrafish)
• Insert Size (bp): 8700
• Entrez Gene: elavl3 (a.k.a. HuC, elrc, id:ibd1248, wu:fb77b03, zHuC)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho1 (not destroyed)
• 3′ cloning site: Age1 (not destroyed)
• 5′ sequencing primer: TGATCTGCAAAAGACGTGAATATC
• 3′ sequencing primer: tttaacctctcagcgagaatgc

Gene/Insert 2

• Gene/Insert name: GCaMP6s
• Species: Synthetic

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: age1 (not destroyed)
• 3′ cloning site: Age1 (not destroyed)
• 5′ sequencing primer: tttaacctctcagcgagaatgc
• 3′ sequencing primer: ATGGGACAATAACAACCAAGGAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: MiniTol2National Institute of Genetics Japan GCaMP6s is from HHMI-Janelia elavl3 promoter is from Brain Science Institute, RIKEN, Japan
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene NGS QC analysis identified multiple variants in the HuC promoter sequence.