pLV-Enh eGFP Reporter-huKC2-IGR21
(Plasmid #59456)

• Purpose: Lentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the human keratin type II cluster.
• Depositing Lab: Benjamin Yu
• Publication: Yu Lab-keratin enhancer GFP reporters (unpublished)

Backbone

• Vector backbone: Brachyury-eGFP
• Backbone size w/o insert (bp): 7967
• Total vector size (bp): 8656
• Modifications to backbone: Original vector is Brachyury-eGFP (Kita-Matsuo et al. 2009) with the Brachyury promoter cloned out and replaced with the minimal Hsp68 promoter from the Hsp68-lacZ-Gateway plasmid (Pennacchio et al. 2006)
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: huKrt1 3’intergenic region
• Alt name: hg18 chr12: 51342842-51343530
• Species: H. sapiens (human)
• Insert Size (bp): 689
• Promoter: Mu Hsp68 minimal promoter

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CGATCCTGTAGTTGTAACCATTCATTATTAG
• 3′ sequencing primer: CCCAGCCCCGCAGCT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry