Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSRKBB-empty
(Plasmid #59449)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59449 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSRK21
  • Backbone size (bp) 5417
  • Modifications to backbone
    We removed all BioBrick™ incompatible sites from pSRK21, as well as sites incompatible with our in-house optimized BioBrick™ system: EcoRI, 2 x NcoI and BglII. We removed the original MCS and replaced it with our optimized BioBrick™ insert.
  • Vector type
    Bacterial Expression
  • Promoter modified lac

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    30 µg/mL kanamycin; 37C for propagation in E. coli. JM109 E. coli can also be used. Rhodococcus opacus strain PD630 is recommended- minimum 50 µg/mL kanamycin. Grow at 30 C when using R. opacus PD630. Depositor growth data show that up to 300 µg/mL kanamycin permits growth.
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TTCATTAATGCAGCTGGCACGAC
  • 3′ sequencing primer TCTGCGGACTGGCTTTCTACG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The plasmid backbone used to derive this plasmid was pSRK21. We received this backbone from Miroslav Pátek at the Institute of Microbiology AS CR, Czech Republic
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSRKBB-empty was a gift from Claudia Schmidt-dannert (Addgene plasmid # 59449 ; http://n2t.net/addgene:59449 ; RRID:Addgene_59449)