pSRKBB-empty
(Plasmid #59449)

• Purpose: (Empty Backbone) Contains BioBrick prefixed and suffixed insert with a modified lac promoter, Shine-Delgarno sequence, 5’ & 3’ MCS, 3’ 6xHis tag.
• Depositing Lab: Claudia Schmidt-dannert
• Publication: BioBrick™ compatible plasmids for Rhodococcus (unpublished)

Backbone

• Vector backbone: pSRK21
• Backbone size (bp): 5417
• Modifications to backbone: We removed all BioBrick™ incompatible sites from pSRK21, as well as sites incompatible with our in-house optimized BioBrick™ system: EcoRI, 2 x NcoI and BglII. We removed the original MCS and replaced it with our optimized BioBrick™ insert.
• Vector type: Bacterial Expression
• Promoter: modified lac

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: 30 µg/mL kanamycin; 37C for propagation in E. coli. JM109 E. coli can also be used. Rhodococcus opacus strain PD630 is recommended- minimum 50 µg/mL kanamycin. Grow at 30 C when using R. opacus PD630. Depositor growth data show that up to 300 µg/mL kanamycin permits growth.
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: TTCATTAATGCAGCTGGCACGAC
• 3′ sequencing primer: TCTGCGGACTGGCTTTCTACG

Resource Information

• Supplemental Documents:
  • pSRKBB-empty GenBank Map
• A portion of this plasmid was derived from a plasmid made by: The plasmid backbone used to derive this plasmid was pSRK21. We received this backbone from Miroslav Pátek at the Institute of Microbiology AS CR, Czech Republic
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry