HA-ISceID44A
(Plasmid #59424)

• Purpose: Expresses a catalytically inactive form of the endonuclease ISceI
• Depositing Lab: Tom Misteli
• Publication: Roukos et al Science. 2013 Aug 9;341(6146):660-4. doi: 10.1126/science.1237150.

Backbone

• Vector backbone: pCAGGS
• Backbone size w/o insert (bp): 4822
• Total vector size (bp): 5656
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: endonuclease ISceI mutant
• Mutation: changed aspartate 44 to alanine (D44A)
• Entrez Gene: I-SceI
• Tag / Fusion Protein:
  • HA tag (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ATGAAAAACATCAAAAAAAACCAGG
• 3′ sequencing primer: TTA TTT CAG GAA AGT TTC GGA GGA G

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Using as template the HA-ISceI plasmid (Rouet et al., Proc. Natl. Acad. Sci. U.S.A. 91, 6064– 6068,1994), a polymerase chain reaction-based strategy was used to construct the mutant form HA-ISceID44A.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry