-
Purposeto make mCherry-Parkin stable cell line with retrovirus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59419 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBMN-Z-LacZ
- Backbone size w/o insert (bp) 4938
- Total vector size (bp) 7080
-
Modifications to backbonelacZ is removed during cloning
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry-Parkin
-
Alt namePark2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2142
-
GenBank IDNM_004562
-
Entrez GenePRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CCCTCAAAGTAGACGGCATC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBMN-mCherry-Parkin was a gift from Richard Youle (Addgene plasmid # 59419 ; http://n2t.net/addgene:59419 ; RRID:Addgene_59419) -
For your References section:
Mitochondrial Rab GAPs govern autophagosome biogenesis during mitophagy. Yamano K, Fogel AI, Wang C, van der Bliek AM, Youle RJ. Elife (Cambridge). 2014 Feb 25;3:e01612. doi: 10.7554/eLife.01612. PubMed 24569479