Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBMN-mCherry-Parkin
(Plasmid #59419)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59419 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBMN-Z-LacZ
  • Backbone size w/o insert (bp) 4938
  • Total vector size (bp) 7080
  • Modifications to backbone
    lacZ is removed during cloning
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mCherry-Parkin
  • Alt name
    Park2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2142
  • GenBank ID
    NM_004562
  • Entrez Gene
    PRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CCCTCAAAGTAGACGGCATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBMN-mCherry-Parkin was a gift from Richard Youle (Addgene plasmid # 59419 ; http://n2t.net/addgene:59419 ; RRID:Addgene_59419)
  • For your References section:

    Mitochondrial Rab GAPs govern autophagosome biogenesis during mitophagy. Yamano K, Fogel AI, Wang C, van der Bliek AM, Youle RJ. Elife (Cambridge). 2014 Feb 25;3:e01612. doi: 10.7554/eLife.01612. PubMed 24569479