pBMN-YFP-Parkin
(Plasmid #59416)

• Purpose: to make YFP-Parkin stable cell line with retrovirus
• Depositing Lab: Richard Youle
• Publication: Yamano et al Elife (Cambridge). 2014 Feb 25;3:e01612. doi: 10.7554/eLife.01612.

Backbone

• Vector backbone: pBMN-Z-LacZ
• Backbone size w/o insert (bp): 4938
• Total vector size (bp): 7089
• Modifications to backbone: LacZ is removed during cloning.
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: YFP-Parkin
• Alt name: Park2
• Species: H. sapiens (human)
• Insert Size (bp): 2142
• GenBank ID: NM_004562
• Entrez Gene: PRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
• Tag / Fusion Protein:
  • EYFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CCCTCAAAGTAGACGGCATC

Resource Information

• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry