Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lenti.pFOXA2.GFP
(Plasmid #59404)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59404 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRL.cPPT.PGK-GFP.WPRE.Sin-18
  • Backbone manufacturer
    D. Trono, EPFL, Lausanne, CH
  • Backbone size w/o insert (bp) 7272
  • Total vector size (bp) 7668
  • Modifications to backbone
    replaced pPGK promoter in pRRL.cPPT.PGK-GFP.WPRE.Sin-18 with 396 bp human 5' FOXA2 promoter region upstream of Exon 1 using 5' XhoI and 3' AgeI restriction sites. Ref.: Navas MA et al., 2000, Human Heredity 50:370-81.
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    400 bp FOXA2 promoter, eGFP
  • Alt name
    HNF3beta promoter
  • Alt name
    Forkhead box A2 promoter
  • Alt name
    TCF-3B promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    396
  • Entrez Gene
    FOXA2 (a.k.a. HNF-3-beta, HNF3B, TCF3B)
  • Promoter pFOXA2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer ggtacagtgcaggggaaag
  • 3′ sequencing primer cagcttgccgtaggtggcatc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti.pFOXA2.GFP was a gift from Kai-Christian Sonntag (Addgene plasmid # 59404 ; http://n2t.net/addgene:59404 ; RRID:Addgene_59404)
  • For your References section:

    Selection Based on FOXA2 Expression Is Not Sufficient to Enrich for Dopamine Neurons From Human Pluripotent Stem Cells. Aguila JC, Blak A, van Arensbergen J, Sousa A, Vazquez N, Aduriz A, Gayosso M, Paz Lopez Mato M, Lopez de Maturana R, Hedlund E, Sonntag K, Sanchez Pernaute R. Stem Cells Transl Med. 2014 Jul 14. pii: sctm.2014-0011. 10.5966/sctm.2014-0011 PubMed 25024431