pSLTS
(Plasmid #59386)

• Purpose: (Empty Backbone) Expresses the lambda Red recombinase under control of the arabinose-inducible P(araB) promoter and I-SceI under control of the anhydrotetracycline-inducible P(tetA) promoter.
• Depositing Lab: Shelley Copley
• Publication: Kim et al BMC Biotechnol. 2014 Sep 25;14(1):84.

Backbone

• Vector backbone: pKDTS
• Backbone manufacturer: Herring and Blattner
• Backbone size (bp): 7742
• Modifications to backbone: We constructed pSLTS by correcting three mutations found in pKDTS. One of these mutations resulted in replacement of 5 amino acid residues at the N-terminus of I-SceI with a single amino acid (MHMKNIK to MHQ), and the other two resulted in missense changes of ASN11 to Ser and Lys33 to Arg in TetR (AAC to AGC and AAG to AGG, respectively). Please see GenBank: KP897155.1 for more details.
• Vector type: Bacterial Expression ; Genome Engineering

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Mach1
• Growth instructions: pSLTS has a temperature sensitive origin of replication and will be lost when cells are grown at temperatures higher than 30 ℃.
• Copy number: Low Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAGGCGCAATCACTTTCGTCTACTC
• 3′ sequencing primer: TTGAGTGACATGCAAAGTAAGTATGATCTC

Resource Information

• Supplemental Documents:
  • GetX python script and documentation
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: pSLTS was constructed from pKDTS, which was originally constructed by C. D. Herring and F. R. Blattner (J. Bacteriology 186: 2673(2004)).
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We developed GetX (https://sourceforge.net/projects/getx/) a stand-alone python script that allows the user to design mutation cassettes for scarless genome editing in bacteria using our previously described two-step recombination method. Please see the document linked under the Resource Information heading above for additional information on installing and using the script.