pMKO.1-puro/hFOXH1 shRNA3
(Plasmid
#59308)
-
PurposeKnockdown of human FOXH1
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59308 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMKO.1-puro
-
Backbone manufacturerAddgene Plasmid #8452
- Backbone size w/o insert (bp) 6700
- Total vector size (bp) 6758
-
Vector typeRetroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehFOXH1 shRNA
-
Alt nameFOXH1
-
gRNA/shRNA sequenceCCGGGCCTATCTACACTCCCAATGTCTCGAGACATTGGGAGTGTAGATAGGCT TTTTG
-
SpeciesH. sapiens (human)
-
GenBank IDNM_003923
-
Entrez GeneFOXH1 (a.k.a. FAST-1, FAST1)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer hU6 F
- 3′ sequencing primer SV40 R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMKO.1-puro/hFOXH1 shRNA3 was a gift from Shinya Yamanaka (Addgene plasmid # 59308 ; http://n2t.net/addgene:59308 ; RRID:Addgene_59308) -
For your References section:
Induction of pluripotency in human somatic cells via a transient state resembling primitive streak-like mesendoderm. Takahashi K, Tanabe K, Ohnuki M, Narita M, Sasaki A, Yamamoto M, Nakamura M, Sutou K, Osafune K, Yamanaka S. Nat Commun. 2014 Apr 24;5:3678. doi: 10.1038/ncomms4678. 10.1038/ncomms4678 PubMed 24759836
Map uploaded by the depositor.