Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLV-Enh eGFP Reporter-huKC1-IGR19
(Plasmid #59285)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59285 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Brachyury-eGFP
  • Backbone size w/o insert (bp) 7967
  • Total vector size (bp) 9717
  • Modifications to backbone
    Original vector is Brachyury-eGFP (Kita-Matsuo et al. 2009) with the Brachyury promoter cloned out and replaced with the minimal Hsp68 promoter from the Hsp68-lacZ-Gateway plasmid (Pennacchio et al. 2006)
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    9kb upstream hKrt14-1700
  • Alt name
    hg18 chr17-37004473-37006222
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1750
  • Promoter Mu Hsp68 minimal promoter

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CACTCACCAGCCCATCACCT
  • 3′ sequencing primer ATATAGACGGATGGATGGATGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-Enh eGFP Reporter-huKC1-IGR19 was a gift from Benjamin Yu (Addgene plasmid # 59285 ; http://n2t.net/addgene:59285 ; RRID:Addgene_59285)