pLV-Enh eGFP Reporter-muKC2-IGR2
(Plasmid
#59271)
-
PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59271 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneBrachyury-eGFP
- Backbone size w/o insert (bp) 7967
- Total vector size (bp) 9366
-
Modifications to backboneOriginal vector is Brachyury-eGFP (Kita-Matsuo et al. 2009) with the Brachyury promoter cloned out and replaced with the minimal Hsp68 promoter from the Hsp68-lacZ-Gateway plasmid (Pennacchio et al. 2006)
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIntergenic 10kb upstream krt80
-
Alt namemm9 chr15:101209000-101210399
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1399
- Promoter Mu Hsp68 minimal promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TGTATTTGAATGTGCAGAGATACAAG
- 3′ sequencing primer CTGTTGCAGGTGATGTGAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-Enh eGFP Reporter-muKC2-IGR2 was a gift from Benjamin Yu (Addgene plasmid # 59271 ; http://n2t.net/addgene:59271 ; RRID:Addgene_59271)
Map uploaded by the depositor.
