pNDamMyc
(Plasmid #59217)

• Purpose: (Empty Backbone) Drosophila DamID vector used to fuse gene of interest to Myc-tagged E.coli Dam.
• Depositing Lab: Bas van Steensel
• Publication: van Steensel et al Nat Biotechnol. 2000 Apr;18(4):424-8.

Backbone

• Vector backbone: pCasper-hs
• Backbone manufacturer: DGRC
• Backbone size (bp): 8780
• Modifications to backbone: inserted full-length ORF of E.Coli Dam methylase followed by a myc epitope tag (EQKLISEEDL)
• Vector type: Insect Expression ; DamID
• Promoter: Drosophila heat-shock promoter
• Tags / Fusion Proteins:
  • Dam (N terminal on backbone)
  • Myc (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: pCasper-hs (GCAACTACTGAAATCTGCCAAG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

myc epitope tag serves as a linker peptide between dam and its fusion partner. This tag can be used to detect the fusion proteins by Western blotting or immunofluorescence microscopy to confirm their correct size and localization. Note that in order to obtain a detectable amount of protein, the fusion protein should be overexpressed by heat shock induction.

This vector can also be used to express the Dam-myc protein by itself (there is a stopcodon 15 aa after the myc-tag).