pLgw EcoDam-V5-RFC1
(Plasmid #59209)

• Purpose: (Empty Backbone) Mammalian DamID lentiviral vector for fusing gene of interest with Dam-V5 using Gateway cloning
• Depositing Lab: Bas van Steensel
• Publication: Vogel et al Genome Res. 2006 Dec;16(12):1493-504. Epub 2006 Oct 12.

Backbone

• Vector backbone: HIV-CS-CG
• Backbone manufacturer: PMID 9733856
• Vector type: Mammalian Expression, Lentiviral ; DamID
• Promoter: Heat Shock Minimal Promoter
• Selectable markers: Zeo marker is outside the LTRs and will not be packaged into virus.
• Tags / Fusion Proteins:
  • Dam (N terminal on backbone)
  • V5 (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Unknown

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: pCasper-hs (GCAACTACTGAAATCTGCCAAG)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The V5 epitope tag serves as a linker between Dam and your favorite protein.

The lentiviral vectors can be used in two ways. When transfected as a conventional plasmid, the strong viral promoter drives high expression of the Dam(fusion) proteins. This should not be used for DamID experiments, but it is useful for checking of the proteins by Western blotting or immunofluorescence microscopy. When used as lentivirus, the strong promoter is deleted upon integration of the virus, and expression of the Dam(fusion) is now driven by the weak pIND-derived heatshock promoter.