pIND(V5)EcoDam
(Plasmid #59201)

• Purpose: (Empty Backbone) Mammalian DamID vector used to fuse gene of interest to V5-tagged E.coli Dam. Can also express Dam alone as negative control.
• Depositing Lab: Bas van Steensel
• Publication: Vogel et al Genome Res. 2006 Dec;16(12):1493-504. Epub 2006 Oct 12.

Backbone

• Vector backbone: pIND/V5-HisA
• Backbone manufacturer: Invitrogen
• Modifications to backbone: E. coli Dam added downstream of V5 tag.
• Vector type: Mammalian Expression ; DamID
• Promoter: Heat Shock Minimal Promoter
• Selectable markers: Neomycin (select with G418)
• Tags / Fusion Proteins:
  • V5 (C terminal on backbone)
  • Dam (DNA adenine methyltransferase) (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: pCasper-hs (GCAACTACTGAAATCTGCCAAG)
• 3′ sequencing primer: BGH-rev

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is an expression vector for E.coli Dam, tagged at its N-terminus with a V5 epitope tag. In front of this tag is a small multiple cloning site for the in-frame cloning of your favorite ORF. The Dam part carries its own start codon, so the vector without any additional insert can be used to express Dam only (the absolutely essential control experiment!). In this case Dam is not V5-tagged, because the V5 tag does not have its own start codon. At present we only have a vector for fusing Dam to the C-terminus of your favorite protein. From work in Drosophila we know that Dam doesn’t mind fusions at its other end, but we don’t have a pIND-derived vector for this yet.

DamID in mammalian cells in principle works with transient transfections. However, we found that transient transfections sometimes cause a nasty artefact. For this reason, we strongly recommend that you either use stably transfected cells or lentivirus transduction for DamID.

Expression is driven by an ecdysone-inducible promoter. For DamID we only use the leaky expression from the uninduced promoter. If you want to check the Dam(fusion) protein by Western blotting or immunofluorescence microscopy, expression must be induced by cotransfection of the activator plasmid pVgRXR and treatment with an ecdysone analog such as Ponasterone A (available from Invitrogen). The pIND backbone contains the neomycin selectable marker for making stable cell lines.