-
PurposeLentiviral vector to express p38 KTR mClover under PGK promoter (With Puromycin Resistance)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLENTI PGK Puro DEST (w529-2)
-
Backbone manufacturerEric Campeau Lab (Addgene Plasmid 19068)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namep38 Kinase Translocation Reporter
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Entrez GeneMAPK14 (a.k.a. CSBP, CSBP1, CSBP2, CSPB1, EXIP, Mxi2, PRKM14, PRKM15, RK, SAPK2A, p38, p38ALPHA)
- Promoter PGK
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiPGK Puro DEST p38KTRClover was a gift from Markus Covert (Addgene plasmid # 59152 ; http://n2t.net/addgene:59152 ; RRID:Addgene_59152) -
For your References section:
High-sensitivity measurements of multiple kinase activities in live single cells. Regot S, Hughey JJ, Bajar BT, Carrasco S, Covert MW. Cell. 2014 Jun 19;157(7):1724-34. doi: 10.1016/j.cell.2014.04.039. 10.1016/j.cell.2014.04.039 PubMed 24949979