pCAG-FLEX-fwd[Chrimson-tdT]
(Plasmid #59137)

• Purpose: Expression vector for Chrimson-tdTomato in a floxed/forward-reading, Cre-dependent manner (Cre turns gene off)
• Depositing Lab: Edward Boyden
• Publication: Klapoetke et al Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9.

Backbone

• Vector backbone: pCAGIG
• Backbone manufacturer: Addgene (Plasmid 11159)
• Backbone size w/o insert (bp): 5113
• Total vector size (bp): 7609
• Vector type: Mammalian Expression, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Chrimson-tdTomato
• Alt name: ChR88-tdTomato
• Alt name: Chlamydomonas noctigama channelrhodopsin
• Species: Chlamydomonas noctigama
• Insert Size (bp): 2496
• GenBank ID: KF992060
• Promoter: CAG
• Tag / Fusion Protein:
  • tdTomato (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CTCTAGAGCCTCTGCTAACC
• 3′ sequencing primer: GATGTCCCCATAATTTTTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositing lab sequenced this plasmid completely except for the CAG promoter.