-
PurposeExpression vector for Chronos-GFP in a floxed/reversed, Cre-dependent manner (Cre turns gene on)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59056 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGIG
-
Backbone manufacturerAddgene (Plasmid 11159)
- Backbone size w/o insert (bp) 5117
- Total vector size (bp) 6827
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChronos-GFP
-
Alt nameChR90-GFP
-
Alt nameStigeoclonium helveticum channelrhodopsin
-
SpeciesStigeoclonium helveticum
-
Insert Size (bp)1710
-
GenBank IDKF992040.1
- Promoter CAG
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
- 3′ sequencing primer GATGTCCCCATAATTTTTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The depositing lab sequenced this plasmid completely except for the CAG promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-FLEX-rc[Chronos-GFP] was a gift from Edward Boyden (Addgene plasmid # 59056 ; http://n2t.net/addgene:59056 ; RRID:Addgene_59056) -
For your References section:
Independent optical excitation of distinct neural populations. Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, Boyden ES. Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9. 10.1038/nmeth.2836 PubMed 24509633