pET-28a+GFP-CAMSAP2 CKK
(Plasmid #59032)

• Purpose: expresses CKK domain of CAMSAP2 in E. coli
• Depositing Lab: Ron Vale
• Publication: Hendershott et al Proc Natl Acad Sci U S A. 2014 Apr 22;111(16):5860-5. doi: 10.1073/pnas.1404133111. Epub 2014 Mar 26.

Backbone

• Vector backbone: pET28a
• Modifications to backbone: vector contains a His tag, Strep tag and sfGFP; a TEV site can be used to cleave off all these tags to get a native construct
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CAMSAP2 CKK domain
• Species: H. sapiens (human)
• Entrez Gene: CAMSAP2 (a.k.a. CAMSAP1L1)
• Tags / Fusion Proteins:
  • His (N terminal on insert)
  • Strep (N terminal on insert)
  • sfGFP (N terminal on insert)
  • TEV (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGAATTGTGAGCGGATAACAATT
• 3′ sequencing primer: GCT AGT TAT TGC TCA GCG G

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry