Addgene: pET-28a+GFP-CAMSAP2 CKK Skip to main content
Addgene

pET-28a+GFP-CAMSAP2 CKK
(Plasmid #59032)

Full plasmid sequence is not available for this item.

Created with RaphaëlpET-28a+GFP-CAMSAP2 CKKCAMSAP2 CKK dom…TEVsfGFPStrepHis

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59032 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28a
  • Modifications to backbone
    vector contains a His tag, Strep tag and sfGFP; a TEV site can be used to cleave off all these tags to get a native construct
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CAMSAP2 CKK domain
  • Species
    H. sapiens (human)
  • Entrez Gene
    CAMSAP2 (a.k.a. CAMSAP1L1)
  • Tags / Fusion Proteins
    • His (N terminal on insert)
    • Strep (N terminal on insert)
    • sfGFP (N terminal on insert)
    • TEV (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAATTGTGAGCGGATAACAATT
  • 3′ sequencing primer GCT AGT TAT TGC TCA GCG G
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-28a+GFP-CAMSAP2 CKK was a gift from Ron Vale (Addgene plasmid # 59032 ; http://n2t.net/addgene:59032 ; RRID:Addgene_59032)
  • For your References section:

    Regulation of microtubule minus-end dynamics by CAMSAPs and Patronin. Hendershott MC, Vale RD. Proc Natl Acad Sci U S A. 2014 Apr 22;111(16):5860-5. doi: 10.1073/pnas.1404133111. Epub 2014 Mar 26. 10.1073/pnas.1404133111 PubMed 24706919