pMRX-IP/SECFP-hATG16A1
(Plasmid #58994)

• Purpose: Expresses SECFP-hATG16A1 in mammalian cells
• Depositing Lab: Noboru Mizushima
• Publication: Koyama-Honda et al Autophagy. 2013 Oct;9(10):1491-9. doi: 10.4161/auto.25529. Epub 2013 Jul 10.

Backbone

• Vector backbone: pMRXIP GFP-Ci2
• Backbone manufacturer: Dr.Shoji Yamaoka of Tokyo Medical and Dental University
• Backbone size w/o insert (bp): 6600
• Vector type: Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Homo sapiens autophagy related 16-like 1 (S. cerevisiae)
• Alt name: ATG16L1
• Species: H. sapiens (human)
• Insert Size (bp): 1765
• GenBank ID: NM_017974
• Entrez Gene: ATG16L1 (a.k.a. APG16L, ATG16A, ATG16L, IBD10, WDR30)
• Tag / Fusion Protein:
  • SECFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGACCACTACCAGCAGAACA
• 3′ sequencing primer: AAAAGACGGCAATATGGTGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: It has the pMX backbone
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry