pmCherry-miR-125b-1
(Plasmid
#58990)
-
PurposeMSCV based expression vector - co-expresses mCherry and human miR-125b-1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58990 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMG (MSCV-based)
-
Vector typeMammalian Expression, Retroviral ; MSCV-based retroviral system
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namemCherry fluorescent protein
-
Insert Size (bp)711
- Promoter MSCV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer caccctaagcctccgcctcctct (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemiR-125b-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)480
-
Entrez GeneMIR125B1 (a.k.a. MIRN125B1, mir-125b-1)
- Promoter MSCV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer caccctaagcctccgcctcctct (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmCherry-miR-125b-1 was a gift from David Baltimore (Addgene plasmid # 58990 ; http://n2t.net/addgene:58990 ; RRID:Addgene_58990) -
For your References section:
Dual mechanisms by which miR-125b represses IRF4 to induce myeloid and B-cell leukemias. So AY, Sookram R, Chaudhuri AA, Minisandram A, Cheng D, Xie C, Lim EL, Flores YG, Jiang S, Kim JT, Keown C, Ramakrishnan P, Baltimore D. Blood. 2014 Aug 28;124(9):1502-12. doi: 10.1182/blood-2014-02-553842. Epub 2014 Jul 8. 10.1182/blood-2014-02-553842 PubMed 25006123