pmCherry-miR-125b-1
(Plasmid #58990)

• Purpose: MSCV based expression vector - co-expresses mCherry and human miR-125b-1
• Depositing Lab: David Baltimore
• Publication: So et al Blood. 2014 Aug 28;124(9):1502-12. doi: 10.1182/blood-2014-02-553842. Epub 2014 Jul 8.

Backbone

• Vector backbone: MG (MSCV-based)
• Vector type: Mammalian Expression, Retroviral ; MSCV-based retroviral system

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: mCherry fluorescent protein
• Insert Size (bp): 711
• Promoter: MSCV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Age1 (not destroyed)
• 3′ cloning site: Not1 (not destroyed)
• 5′ sequencing primer: caccctaagcctccgcctcctct

Gene/Insert 2

• Gene/Insert name: miR-125b-1
• Species: H. sapiens (human)
• Insert Size (bp): 480
• Entrez Gene: MIR125B1 (a.k.a. MIRN125B1, mir-125b-1)
• Promoter: MSCV

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Not1 (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: caccctaagcctccgcctcctct

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry