Addgene: pHcRed-miR-125b-1 Skip to main content
Addgene

pHcRed-miR-125b-1
(Plasmid #58989)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58989 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MG
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    HcRed fluorescent protein
  • Promoter MSCV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer caccctaagcctccgcctcctct
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    miR-125b-1
  • Species
    H. sapiens (human)
  • Entrez Gene
    MIR125B1 (a.k.a. MIRN125B1, mir-125b-1)
  • Promoter MSCV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer caccctaagcctccgcctcctct
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHcRed-miR-125b-1 was a gift from David Baltimore (Addgene plasmid # 58989 ; http://n2t.net/addgene:58989 ; RRID:Addgene_58989)
  • For your References section:

    Dual mechanisms by which miR-125b represses IRF4 to induce myeloid and B-cell leukemias. So AY, Sookram R, Chaudhuri AA, Minisandram A, Cheng D, Xie C, Lim EL, Flores YG, Jiang S, Kim JT, Keown C, Ramakrishnan P, Baltimore D. Blood. 2014 Aug 28;124(9):1502-12. doi: 10.1182/blood-2014-02-553842. Epub 2014 Jul 8. 10.1182/blood-2014-02-553842 PubMed 25006123