-
PurposeMSCV based expression vector - co-expresses GFP and murine IRF4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58987 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMIG
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMouse IRF4
-
Alt nameinterferon regulatory factor 4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1353
-
Entrez GeneIrf4 (a.k.a. IRF-4, LSIRF, NF-EM5, Spip)
- Promoter MSCV
-
Tag
/ Fusion Protein
- Kozak sequence added
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer caccctaagcctccgcctcctct (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMIG-IRF4 was a gift from David Baltimore (Addgene plasmid # 58987 ; http://n2t.net/addgene:58987 ; RRID:Addgene_58987) -
For your References section:
Dual mechanisms by which miR-125b represses IRF4 to induce myeloid and B-cell leukemias. So AY, Sookram R, Chaudhuri AA, Minisandram A, Cheng D, Xie C, Lim EL, Flores YG, Jiang S, Kim JT, Keown C, Ramakrishnan P, Baltimore D. Blood. 2014 Aug 28;124(9):1502-12. doi: 10.1182/blood-2014-02-553842. Epub 2014 Jul 8. 10.1182/blood-2014-02-553842 PubMed 25006123