Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMitoLOC
(Plasmid #58980)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58980 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUG35
  • Backbone size w/o insert (bp) 4872
  • Total vector size (bp) 8213
  • Modifications to backbone
    NAT resistance
  • Vector type
    Yeast Expression
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    704
  • Promoter ADH1
  • Tag / Fusion Protein
    • preCOX4 (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstBI (not destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer AATTGTGAGCGGATAACAATTTCA
  • 3′ sequencing primer GTGCCACCTTTTCGACACTT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GFP
  • Alt name
    mtGFP
  • Species
    Synthetic
  • Insert Size (bp)
    716
  • Promoter MET17
  • Tag / Fusion Protein
    • preSU9 (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer AAGTGTCGAAAAGGTGGCAC
  • 3′ sequencing primer GTTTTCCCAGTCACGAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pYES_mtGFP: B. Westermann pHS12: C. Dunn
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMitoLOC was a gift from Markus Ralser (Addgene plasmid # 58980 ; http://n2t.net/addgene:58980 ; RRID:Addgene_58980)
  • For your References section:

    MitoLoc: A method for the simultaneous quantification of mitochondrial network morphology and membrane potential in single cells. Vowinckel J, Hartl J, Butler R, Ralser M. Mitochondrion. 2015 Sep;24:77-86. doi: 10.1016/j.mito.2015.07.001. Epub 2015 Jul 13. 10.1016/j.mito.2015.07.001 PubMed 26184437