pMitoLOC
(Plasmid #58980)

• Purpose: Expression of preCOX4-mCherry & preSU9-GFP for colocalisation analysis of yeast mitochondrila
• Depositing Lab: Markus Ralser
• Publication: Vowinckel et al Mitochondrion. 2015 Sep;24:77-86. doi: 10.1016/j.mito.2015.07.001. Epub 2015 Jul 13.

Backbone

• Vector backbone: pUG35
• Backbone size w/o insert (bp): 4872
• Total vector size (bp): 8213
• Modifications to backbone: NAT resistance
• Vector type: Yeast Expression
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 704
• Promoter: ADH1
• Tag / Fusion Protein:
  • preCOX4 (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BstBI (not destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: AATTGTGAGCGGATAACAATTTCA
• 3′ sequencing primer: GTGCCACCTTTTCGACACTT

Gene/Insert 2

• Gene/Insert name: GFP
• Alt name: mtGFP
• Species: Synthetic
• Insert Size (bp): 716
• Promoter: MET17
• Tag / Fusion Protein:
  • preSU9 (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRV (destroyed during cloning)
• 5′ sequencing primer: AAGTGTCGAAAAGGTGGCAC
• 3′ sequencing primer: GTTTTCCCAGTCACGAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pYES_mtGFP: B. Westermann pHS12: C. Dunn
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry