Tg (mpx:mCherry-2A-Rac2D57N)
(Plasmid #58934)

• Purpose: expresses dominant negative rac2 tagged with mcherry in neutrophils
• Depositing Lab: Anna Huttenlocher
• Publication: Deng et al Dev Cell. 2011 Oct 18;21(4):735-45. doi: 10.1016/j.devcel.2011.07.013.

Backbone

• Vector backbone: Tol2
• Backbone size w/o insert (bp): 3500
• Total vector size (bp): 13155
• Modifications to backbone: Inserted mpx-mcherry-2a-Rac2D57N

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mcherry-2a-Rac2D57N
• Species: D. rerio (zebrafish)
• Insert Size (bp): 1353
• Mutation: changed Aspartate 57 to Asparagine
• Entrez Gene: rac2 (a.k.a. zgc:86686)
• Promoter: mpx
• Tag / Fusion Protein:
  • mcherry2a (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: Gtgaaagtacaagtacttagggaaaa
• 3′ sequencing primer: gtgtggaattgtgagcggataac

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry