FKBP_LD 0_TEV
(Plasmid #58877)

• Purpose: MESA protease chain with Rapamycin FKBP ectodomain and no linker domain
• Depositing Lab: Joshua Leonard
• Publication: Daringer et al ACS Synth Biol. 2014 Mar 11.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5521
• Total vector size (bp): 6871
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MESA protease chain with FKBP rapamycin-binding ectodomain, TEV protease and mCherry fusion
• Species: Synthetic
• Insert Size (bp): 1350
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ATGTGCCGAGCCATCTCTCT
• 3′ sequencing primer: CTAATTCATGAGTTGAGTCG

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry