FRB_LD 0_CS G_tTA-BFP
(Plasmid #58876)

• Purpose: MESA target chain with Rapamycin FRB ectodomain, no linker domain, G cleavage sequence, and tTA-BFP fusion
• Depositing Lab: Joshua Leonard
• Publication: Daringer et al ACS Synth Biol. 2014 Mar 11.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5518
• Total vector size (bp): 7768
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MESA target chain with FRB ectodomain, cd28 transmembrane domain, wild type TEV cleavage sequence
• Species: Synthetic
• Insert Size (bp): 2250
• Promoter: CMV
• Tag / Fusion Protein:
  • EBFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ATGTGCCGAGCCATCTCTCT
• 3′ sequencing primer: TTACTTGTACAGCTCGTCCA

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry