mCherry_LD 0_CS M_tTA-BFP
(Plasmid
#58874)
-
PurposeMESA target chain with mCherry ectodomain, no linker domain, M cleavage sequence, and tTA-BFP fusion
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMESA target chain with mCherry ectodomain, cd28 transmembrane domain, mutated TEV cleavage sequence (M in P1')
-
SpeciesSynthetic
-
Insert Size (bp)2640
- Promoter CMV
-
Tag
/ Fusion Protein
- EBFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ATGTGCCGAGCCATCTCTCT
- 3′ sequencing primer TTACTTGTACAGCTCGTCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry_LD 0_CS M_tTA-BFP was a gift from Joshua Leonard (Addgene plasmid # 58874 ; http://n2t.net/addgene:58874 ; RRID:Addgene_58874) -
For your References section:
Modular Extracellular Sensor Architecture for Engineering Mammalian Cell-based Devices. Daringer NM, Dudek RM, Schwarz KA, Leonard JN. ACS Synth Biol. 2014 Mar 11. 10.1021/sb400128g PubMed 24611683