pBI-MCS-EYFP
(Plasmid #58855)

• Purpose: The tet-responsive reporter pBI-MCS-EGFP (Addgene plasmid 16542) was modified to express YFP instead of GFP
• Depositing Lab: Joshua Leonard
• Publication: Daringer et al ACS Synth Biol. 2014 Mar 11.

Backbone

• Vector backbone: pBI-MCS-EGFP
• Backbone size w/o insert (bp): 4401
• Total vector size (bp): 5121
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: enhanced yellow fluorescent protein
• Alt name: EYFP
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ttacttgtacagctcgtccat
• 3′ sequencing primer: atggtgagcaagggcgaggag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Backbone is addgene plasmid 16542, pBI-MCS-EGFP
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry