tTA_BFP
(Plasmid #58854)

• Purpose: Constitutive expression of tTA-EBFP fusion protein (tTA from CL-CTIG, Addgene plasmid 14901)
• Depositing Lab: Joshua Leonard
• Publication: Daringer et al ACS Synth Biol. 2014 Mar 11.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5412
• Total vector size (bp): 7167
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tTA transcription factor fused to enhanced blue fluorescent protein
• Species: Synthetic
• Insert Size (bp): 1755
• Promoter: CMV
• Tag / Fusion Protein:
  • BFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: atgtctagattagataaaag
• 3′ sequencing primer: tagaaggcacagtcgagg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry